Product Details

SNP ID: rs77567304
Assay Type: Functionally tested
NCBI dbSNP Submissions: 7
Location: Chr.1:209615465 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTGATGGTGAGACTCCCCAAGACT[C/T]CCAACCCTTCCTTCCCCTCCTGCTA
Phenotype: MIM: 614994 MIM: 150310
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CAMK1G PubMed Links

Gene Details

Gene: CAMK1G
Gene Name: calcium/calmodulin dependent protein kinase IG

There are no transcripts associated with this gene.

Gene: LAMB3
Gene Name: laminin subunit beta 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000228.2		Intron			NP_000219.2
NM_001017402.1		Intron			NP_001017402.1
NM_001127641.1		Intron			NP_001121113.1
XM_005273124.4		Intron			XP_005273181.1
XM_017001272.1		Intron			XP_016856761.1

Gene: MIR4260
Gene Name: microRNA 4260

There are no transcripts associated with this gene.

View Full Product Details