Product Details

SNP ID: rs11064255
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6560091 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTGGTGACGAAGGGAAGAAAAAGAT[C/T]ACTTACCTGTCTGGGACTGAGGGAT
Phenotype: MIM: 603277 MIM: 610495 MIM: 164031
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHD4 PubMed Links

Gene Details

Gene: CHD4
Gene Name: chromodomain helicase DNA binding protein 4

There are no transcripts associated with this gene.

Gene: IFFO1
Gene Name: intermediate filament family orphan 1

There are no transcripts associated with this gene.

Gene: NOP2
Gene Name: NOP2 nucleolar protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001033714.2		Intron			NP_001028886.1
NM_001258308.1		Intron			NP_001245237.1
NM_001258309.1		Intron			NP_001245238.1
NM_001258310.1		Intron			NP_001245239.1
NM_006170.3		Intron			NP_006161.2
XM_005253691.1		Intron			XP_005253748.1

View Full Product Details