Product Details

SNP ID: rs3763616
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:89319872 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATGGTGATTAGACTTTCAAATACTC[A/G]GCAGTTACTGCACTAAAGTTCTGCA
Phenotype: MIM: 116901 MIM: 607693
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CKS2 PubMed Links

Gene Details

Gene: CKS2
Gene Name: CDC28 protein kinase regulatory subunit 2

There are no transcripts associated with this gene.

Gene: MIR3153
Gene Name: microRNA 3153

There are no transcripts associated with this gene.

Gene: SECISBP2
Gene Name: SECIS binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282688.1		Intron			NP_001269617.1
NM_001282689.1		Intron			NP_001269618.1
NM_001282690.1		Intron			NP_001269619.1
NM_024077.4		Intron			NP_076982.3
XM_005252196.2		Intron			XP_005252253.1
XM_005252202.3		Intron			XP_005252259.1
XM_006717282.2		Intron			XP_006717345.1
XM_011519000.2		Intron			XP_011517302.1
XM_011519001.1		Intron			XP_011517303.1
XM_011519002.1		Intron			XP_011517304.1
XM_011519003.1		Intron			XP_011517305.1
XM_017015122.1		Intron			XP_016870611.1
XM_017015123.1		Intron			XP_016870612.1
XM_017015124.1		Intron			XP_016870613.1
XM_017015125.1		Intron			XP_016870614.1

View Full Product Details