Product Details

SNP ID: rs35614109
Assay Type: Functionally tested
NCBI dbSNP Submissions: 16
Location: Chr.1:159952473 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTCCACAGAGCACACCAGGGACAT[A/G]CTGCAGGCACCTTCCCCAGAACTCT
Phenotype: MIM: 609738 MIM: 608589
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IGSF9 PubMed Links

Gene Details

Gene: IGSF9
Gene Name: immunoglobulin superfamily member 9

There are no transcripts associated with this gene.

Gene: LINC01133
Gene Name: long intergenic non-protein coding RNA 1133

There are no transcripts associated with this gene.

Gene: SLAMF9
Gene Name: SLAM family member 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001146172.1	570	Intron			NP_001139644.1
NM_001146173.1	570	Intron			NP_001139645.1
NM_033438.3	570	Silent Mutation	AGC,AGT	S151S	NP_254273.2
XM_017002756.1	570	Silent Mutation	AGC,AGT	S181S	XP_016858245.1

View Full Product Details