Product Details

SNP ID: rs7885663
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:53085145 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACCAGAGAAGGCCTTGCTAGGCTTG[C/T]TCCTGGGTGCGTGGGGAATTAAGAG
Phenotype: MIM: 300253 MIM: 300564
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GPR173 PubMed Links

Gene Details

Gene: GPR173
Gene Name: G protein-coupled receptor 173

There are no transcripts associated with this gene.

Gene: KANTR
Gene Name: KDM5C adjacent non-coding transcript

There are no transcripts associated with this gene.

Gene: TSPYL2
Gene Name: TSPY like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022117.3		Intron			NP_071400.1
XM_006724592.3		Intron			XP_006724655.1
XM_017029726.1		Intron			XP_016885215.1
XM_017029727.1		Intron			XP_016885216.1

View Full Product Details