Product Details

SNP ID: hCV25953404
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:35809129 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCTTTTCTTTGATTCCTCATTCCA[C/T]CATCCTCCCCATTCCACCCACCCCA
Phenotype: MIM: 609997 MIM: 108961 MIM: 605731
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAM221B PubMed Links

Gene Details

Gene: FAM221B
Gene Name: family with sequence similarity 221 member B

There are no transcripts associated with this gene.

Gene: HINT2
Gene Name: histidine triad nucleotide binding protein 2

There are no transcripts associated with this gene.

Gene: NPR2
Gene Name: natriuretic peptide receptor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003995.3		Intron			NP_003986.2

Gene: SPAG8
Gene Name: sperm associated antigen 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039592.1		Intron			NP_001034681.1
NM_172312.1		Intron			NP_758516.1

View Full Product Details