Product Details

SNP ID: rs3116068
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:66337522 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAAACTGGCTCCCTGGCCCTGAGGC[C/T]GGACAGCCTGCATCCAACATCAGCA
Phenotype: MIM: 605517 MIM: 606259 MIM: 605965
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: B4GAT1 PubMed Links

Gene Details

Gene: B4GAT1
Gene Name: beta-1,4-glucuronyltransferase 1

There are no transcripts associated with this gene.

Gene: BRMS1
Gene Name: breast cancer metastasis suppressor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001024957.1	1248	UTR 3			NP_001020128.1
NM_015399.3	1248	UTR 3			NP_056214.1

Gene: RIN1
Gene Name: Ras and Rab interactor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004292.2	1248	Intron			NP_004283.2
XM_011545399.2	1248	Intron			XP_011543701.1
XM_011545400.2	1248	Intron			XP_011543702.1
XM_011545401.2	1248	Intron			XP_011543703.1
XM_017018587.1	1248	Intron			XP_016874076.1

View Full Product Details