Product Details

SNP ID

rs2925624

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.16:28607224 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CGGCACCGGTAGGGCCAAGTCAGGA[T/G]CTGAACCCTGCTCAGAAGCCAAAGT

Phenotype

MIM: 171150

Polymorphism

T/G, Transversion substitution

Allele Nomenclature

Literature Links

SULT1A1 PubMed Links

Additional Information

The SULT1A1 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of SULT1A1. SULT1A1 SNP genotyping assays run on samples having 2 or more gene copies that are homozygous for the SNP allele will cluster together, and samples having more than 2 gene copies that are heterozygous may run between the 2 copy heterozygous and homozygous clusters. For accurate SULT1A1 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.

Gene Details

Gene

SULT1A1

Gene Name

sulfotransferase family 1A member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001055.3		Intron			NP_001046.2
NM_177529.2		Intron			NP_803565.1
NM_177530.2		Intron			NP_803566.1
NM_177534.2		Intron			NP_803878.1
NM_177536.3		Intron			NP_803880.1
XM_017023604.1		Intron			XP_016879093.1
XM_017023605.1		Intron			XP_016879094.1
XM_017023606.1		Intron			XP_016879095.1
XM_017023607.1		Intron			XP_016879096.1
XM_017023608.1		Intron			XP_016879097.1
XM_017023609.1		Intron			XP_016879098.1
XM_017023610.1		Intron			XP_016879099.1
XM_017023611.1		Intron			XP_016879100.1
XM_017023612.1		Intron			XP_016879101.1
XM_017023613.1		Intron			XP_016879102.1

View Full Product Details