Product Details
- SNP ID
-
rs2925624
- Assay Type
- Functionally tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:28607224 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CGGCACCGGTAGGGCCAAGTCAGGA[T/G]CTGAACCCTGCTCAGAAGCCAAAGT
- Phenotype
-
MIM: 171150
- Polymorphism
- T/G, Transversion substitution
- Allele Nomenclature
-
- Literature Links
-
SULT1A1
PubMed Links
- Additional Information
-
The SULT1A1 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of SULT1A1. SULT1A1 SNP genotyping assays run on samples having 2 or more gene copies that are homozygous for the SNP allele will cluster together, and samples having more than 2 gene copies that are heterozygous may run between the 2 copy heterozygous and homozygous clusters. For accurate SULT1A1 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
Gene Details
- Gene
- SULT1A1
- Gene Name
- sulfotransferase family 1A member 1
View Full Product Details