Product Details

SNP ID: rs36071991
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:18473406 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCACTACAGTAAAATGAAGGGATC[C/T]GATAACCAAGAAAAACTAGTATATC
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DZANK1 PubMed Links

Gene Details

Gene: DZANK1
Gene Name: double zinc ribbon and ankyrin repeat domains 1

There are no transcripts associated with this gene.

Gene: MIR3192
Gene Name: microRNA 3192

There are no transcripts associated with this gene.

Gene: POLR3F
Gene Name: RNA polymerase III subunit F

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282526.1	381	Silent Mutation	TCC,TCT	S47S	NP_001269455.1
NM_006466.3	381	Silent Mutation	TCC,TCT	S88S	NP_006457.2
XM_011529141.1	381	Silent Mutation	TCC,TCT	S4S	XP_011527443.1
XM_017027596.1	381	Silent Mutation	TCC,TCT	S88S	XP_016883085.1

View Full Product Details