Product Details

SNP ID
rs28623434
Assay Type
Functionally Tested
NCBI dbSNP Submissions
35
Location
Chr.1:1618213 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CTGCACTTCCCATAGCAGCCTCTGG[G/C]CCAGAGCTCACCCGCTGTGGGCAGG
Phenotype
MIM: 611141
Polymorphism
G/C, Transversion Substitution
Allele Nomenclature
Literature Links
MIB2 PubMed Links
Additional Information
For this assay, SNP(s) [rs142389064] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
MIB2
Gene Name
mindbomb E3 ubiquitin protein ligase 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001170686.1 Intron NP_001164157.1
NM_001170687.1 Intron NP_001164158.1
NM_001170688.1 Intron NP_001164159.1
NM_001170689.1 Intron NP_001164160.1
NM_080875.2 Intron NP_543151.2
XM_006710372.1 Intron XP_006710435.1
XM_011540731.2 Intron XP_011539033.1
XM_011540736.2 Intron XP_011539038.1
XM_011540737.2 Intron XP_011539039.1
XM_011540741.2 Intron XP_011539043.1
XM_011540742.2 Intron XP_011539044.1
XM_017000349.1 Intron XP_016855838.1
XM_017000350.1 Intron XP_016855839.1
XM_017000351.1 Intron XP_016855840.1
XM_017000352.1 Intron XP_016855841.1
XM_017000353.1 Intron XP_016855842.1
XM_017000354.1 Intron XP_016855843.1
XM_017000355.1 Intron XP_016855844.1
XM_017000356.1 Intron XP_016855845.1
XM_017000357.1 Intron XP_016855846.1
XM_017000358.1 Intron XP_016855847.1
XM_017000359.1 Intron XP_016855848.1
XM_017000360.1 Intron XP_016855849.1
XM_017000361.1 Intron XP_016855850.1
XM_017000362.1 Intron XP_016855851.1
XM_017000363.1 Intron XP_016855852.1
XM_017000364.1 Intron XP_016855853.1
XM_017000365.1 Intron XP_016855854.1
XM_017000366.1 Intron XP_016855855.1

View Full Product Details