Product Details

SNP ID: rs2965683
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:8225456 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTATCTTTTTGGCTTTAGCTCCAG[C/G]CCCTCTTTATTTATTTTTCTGGTAT
Phenotype: MIM: 613041
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FAM86FP PubMed Links

Gene Details

Gene: FAM86FP
Gene Name: family with sequence similarity 86, member A pseudogene

There are no transcripts associated with this gene.

Gene: FAM90A1
Gene Name: family with sequence similarity 90 member A1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001319982.1		Intron			NP_001306911.1
NM_018088.3		Intron			NP_060558.3
XM_006719097.3		Intron			XP_006719160.1
XM_011520719.1		Intron			XP_011519021.1
XM_017019547.1		Intron			XP_016875036.1

Gene: LOC101927905
Gene Name: uncharacterized LOC101927905

There are no transcripts associated with this gene.

View Full Product Details