Product Details

SNP ID

rs72547525

Assay Type

DME

NCBI dbSNP Submissions

NA

Location

Chr.16:28608495 on Build GRCh38

Set Membership

DME Validated Inventoried

Context Sequence [VIC/FAM]

TCACACACCTGAGGGAATCCCTGGG[G/A]CTTTGAACTCAAGGAAGGGCACCCG

Phenotype

MIM: 171150

Polymorphism

G/A, Transition substitution

Allele Nomenclature

Literature Links

SULT1A1 PubMed Links

Additional Information

The SULT1A1 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of SULT1A1. SULT1A1 SNP genotyping assays run on samples having 2 or more gene copies that are homozygous for the SNP allele will cluster together, and samples having more than 2 gene copies that are heterozygous may run between the 2 copy heterozygous and homozygous clusters. For accurate SULT1A1 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.

Gene Details

Gene

SULT1A1

Gene Name

sulfotransferase family 1A member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001055.3	687	Missense Mutation			NP_001046.2
NM_177529.2	687	Missense Mutation			NP_803565.1
NM_177530.2	687	Missense Mutation			NP_803566.1
NM_177534.2	687	Missense Mutation			NP_803878.1
NM_177536.3	687	Intron			NP_803880.1
XM_017023604.1	687	Missense Mutation			XP_016879093.1
XM_017023605.1	687	Missense Mutation			XP_016879094.1
XM_017023606.1	687	Missense Mutation			XP_016879095.1
XM_017023607.1	687	Missense Mutation			XP_016879096.1
XM_017023608.1	687	Missense Mutation			XP_016879097.1
XM_017023609.1	687	Missense Mutation			XP_016879098.1
XM_017023610.1	687	Missense Mutation			XP_016879099.1
XM_017023611.1	687	Missense Mutation			XP_016879100.1
XM_017023612.1	687	Missense Mutation			XP_016879101.1
XM_017023613.1	687	Missense Mutation			XP_016879102.1

View Full Product Details