Product Details

SNP ID: rs6090043
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:64086577 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CATGTTTATTGCTGCCAAGGCCTGA[C/T]GATGAAACTTCAAGTCAAATTAGTA
Phenotype: MIM: 602548 MIM: 605071
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LKAAEAR1 PubMed Links

Gene Details

Gene: LKAAEAR1
Gene Name: LKAAEAR motif containing 1

There are no transcripts associated with this gene.

Gene: MIR6813
Gene Name: microRNA 6813

There are no transcripts associated with this gene.

Gene: OPRL1
Gene Name: opioid related nociceptin receptor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000913.5	339	Intron			NP_000904.1
NM_001200019.1	339	UTR 5			NP_001186948.1
NM_001318853.1	339	Intron			NP_001305782.1
NM_001318854.1	339	Intron			NP_001305783.1
NM_001318855.1	339	Intron			NP_001305784.1
NM_182647.3	339	Intron			NP_872588.1
XM_011528828.2	339	UTR 5			XP_011527130.1
XM_011528830.2	339	UTR 5			XP_011527132.1
XM_017027852.1	339	UTR 5			XP_016883341.1
XM_017027853.1	339	UTR 5			XP_016883342.1
XM_017027854.1	339	Intron			XP_016883343.1
XM_017027855.1	339	Intron			XP_016883344.1

Gene: RGS19
Gene Name: regulator of G-protein signaling 19

There are no transcripts associated with this gene.

View Full Product Details