Product Details
- SNP ID
-
rs35871424
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:67172969 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CAAAAAATATATATAGCAAGACCCC[A/C]CCTCTAAAAAAAAAAAAAAAAAAAA
- Phenotype
-
MIM: 609077
MIM: 602438
MIM: 605235
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
FBXL8
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs544086850] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- FBXL8
- Gene Name
- F-box and leucine rich repeat protein 8
There are no transcripts associated with this gene.
- Gene
- HSF4
- Gene Name
- heat shock transcription factor 4
There are no transcripts associated with this gene.
- Gene
- KIAA0895L
- Gene Name
- KIAA0895 like
There are no transcripts associated with this gene.
- Gene
- NOL3
- Gene Name
- nucleolar protein 3
View Full Product Details