Product Details

SNP ID: rs3206671
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:75400815 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAACCAGGACAGAAATCATTATCT[A/T]AGCCACCAGGTAAAACTCATTTGAC
Phenotype: MIM: 600454 MIM: 600455
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: RPS3 PubMed Links

Gene Details

Gene: RPS3
Gene Name: ribosomal protein S3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005.4	209	Nonsense Mutation	TAA,TTA	*51L	NP_000996.2
NM_001256802.1	209	Nonsense Mutation	TAA,TTA	*51L	NP_001243731.1
NM_001260506.1	209	Nonsense Mutation	TAA,TTA	*51L	NP_001247435.1
NM_001260507.1	209	Intron			NP_001247436.1

Gene: SNORD15A
Gene Name: small nucleolar RNA, C/D box 15A

There are no transcripts associated with this gene.

Gene: SNORD15B
Gene Name: small nucleolar RNA, C/D box 15B

There are no transcripts associated with this gene.

View Full Product Details