Product Details

SNP ID: rs3745099
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:52398652 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGGGTTTGCAGAGGCACAGTGAAA[A/G]AAGGTGCCGAGAAAATAGCAGGGGA
Phenotype: MIM: 615580
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ZNF528 PubMed Links

Gene Details

Gene: ZNF528
Gene Name: zinc finger protein 528

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032423.2		Intron			NP_115799.2
XM_005259323.1		Intron			XP_005259380.1
XM_006723418.2		Intron			XP_006723481.1
XM_011527392.1		Intron			XP_011525694.1
XM_011527394.2		Intron			XP_011525696.1
XM_017027360.1		Intron			XP_016882849.1
XM_017027361.1		Intron			XP_016882850.1
XM_017027362.1		Intron			XP_016882851.1
XM_017027363.1		Intron			XP_016882852.1
XM_017027364.1		Intron			XP_016882853.1
XM_017027365.1		Intron			XP_016882854.1

Gene: ZNF528-AS1
Gene Name: ZNF528 antisense RNA 1

There are no transcripts associated with this gene.

Gene: ZNF880
Gene Name: zinc finger protein 880

There are no transcripts associated with this gene.

View Full Product Details