Product Details

SNP ID: rs3793659
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:136667383 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGACCCTGCAGCATGGCAGGGGCTC[A/G]CCAGGTCTCCAGACCCCTGGCTGCG
Phenotype: MIM: 603100 MIM: 608582 MIM: 611767
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AGPAT2 PubMed Links

Gene Details

Gene: AGPAT2
Gene Name: 1-acylglycerol-3-phosphate O-acyltransferase 2

There are no transcripts associated with this gene.

Gene: EGFL7
Gene Name: EGF like domain multiple 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016215.4		Intron			NP_057299.1
NM_201446.2		Intron			NP_958854.1
XM_006717141.3		Intron			XP_006717204.1
XM_011518764.1		Intron			XP_011517066.1
XM_011518765.1		Intron			XP_011517067.1
XM_011518766.1		Intron			XP_011517068.1
XM_011518767.1		Intron			XP_011517069.1
XM_011518768.1		Intron			XP_011517070.1
XM_017014795.1		Intron			XP_016870284.1
XM_017014796.1		Intron			XP_016870285.1
XM_017014797.1		Intron			XP_016870286.1
XM_017014798.1		Intron			XP_016870287.1
XM_017014799.1		Intron			XP_016870288.1

Gene: HSPC324
Gene Name: uncharacterized LOC101928612

There are no transcripts associated with this gene.

Gene: MIR126
Gene Name: microRNA 126

There are no transcripts associated with this gene.

View Full Product Details