Product Details
- SNP ID
-
rs4078247
- Assay Type
- Functionally tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:42125980 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGTGGTGAGGTGACGAGGCTGAGGG[C/T]GGTGGCTCAGTCCTGGGCTTCCATG
- Phenotype
-
MIM: 124030
- Polymorphism
- C/T, Transition substitution
- Allele Nomenclature
-
- Literature Links
-
CYP2D6
PubMed Links
- Additional Information
-
The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
Gene Details
- Gene
- CYP2D6
- Gene Name
- cytochrome P450 family 2 subfamily D member 6
- Gene
- LOC102723722
- Gene Name
- uncharacterized LOC102723722
There are no transcripts associated with this gene.
- Gene
- NDUFA6-AS1
- Gene Name
- NDUFA6 antisense RNA 1 (head to head)
There are no transcripts associated with this gene.
View Full Product Details