Product Details

SNP ID: rs73884899
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:184233207 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTTGTCTTGGATCTGGCCCAGGCC[C/G]GGTCCACGTTGGTGCTGCCCACAGG
Phenotype: MIM: 608750 MIM: 611620
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ALG3 PubMed Links

Gene Details

Gene: ALG3
Gene Name: ALG3, alpha-1,3- mannosyltransferase

There are no transcripts associated with this gene.

Gene: MIR1224
Gene Name: microRNA 1224

There are no transcripts associated with this gene.

Gene: VWA5B2
Gene Name: von Willebrand factor A domain containing 5B2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320373.1	610	Intron			NP_001307302.1
NM_138345.2	610	Missense Mutation	CGG,GGG	R114G	NP_612354.1
XM_011513288.2	610	Missense Mutation	CGG,GGG	R114G	XP_011511590.1
XM_011513289.2	610	Missense Mutation	CGG,GGG	R114G	XP_011511591.1
XM_011513290.2	610	Missense Mutation	CGG,GGG	R114G	XP_011511592.1
XM_011513291.2	610	Missense Mutation	CGG,GGG	R114G	XP_011511593.1
XM_011513292.2	610	Missense Mutation	CGG,GGG	R114G	XP_011511594.1

View Full Product Details