Product Details

SNP ID: rs76772198
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:3668752 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCGGAGCGTGTCCGGGGCGCCCAC[A/G]GCGCAGGCGCGGAGGGCGGGGCGGG
Phenotype: MIM: 606272 MIM: 602836 MIM: 616484
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CTNS PubMed Links

Gene Details

Gene: CTNS
Gene Name: cystinosin, lysosomal cystine transporter

There are no transcripts associated with this gene.

Gene: EMC6
Gene Name: ER membrane protein complex subunit 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014764.2	30	UTR 5			NP_001014764.1
NM_031298.3	30	UTR 5			NP_112588.1

Gene: P2RX5
Gene Name: purinergic receptor P2X 5

There are no transcripts associated with this gene.

Gene: P2RX5-TAX1BP3
Gene Name: P2RX5-TAX1BP3 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: TAX1BP3
Gene Name: Tax1 binding protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204698.1	30	Intron			NP_001191627.1
NM_014604.3	30	Intron			NP_055419.1

View Full Product Details