Product Details

SNP ID: rs6959246
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.7:16462027 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTACAGGGCTTATTTTTGAAGTGA[A/G]ATGTCACAGGGTCTTTCATTCTCTT
Phenotype: MIM: 609675
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: SOSTDC1 PubMed Links
Additional Information: For this assay, SNP(s) [rs75086831] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015464.2	1323	UTR 3			NP_056279.1
XM_017011943.1	1323	UTR 3			XP_016867432.1