Product Details

SNP ID: rs6689338
Assay Type: Functionally tested
NCBI dbSNP Submissions: 20
Location: Chr.1:150283248 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTTGGGTACTCCAGGAGCTGTTCTA[A/T]AGCCCCTGCTTCTGGACCTATGGAT
Phenotype: MIM: 607629 MIM: 615782
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: APH1A PubMed Links

Gene Details

Gene: APH1A
Gene Name: aph-1 homolog A, gamma-secretase subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077628.2	58	Intron			NP_001071096.1
NM_001243771.1	58	Intron			NP_001230700.1
NM_001243772.1	58	Intron			NP_001230701.1
NM_016022.3	58	Intron			NP_057106.2
XM_017001417.1	58	Intron			XP_016856906.1

Gene: C1orf54
Gene Name: chromosome 1 open reading frame 54

There are no transcripts associated with this gene.

Gene: CIART
Gene Name: circadian associated repressor of transcription

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300838.1	58	UTR 5			NP_001287767.1
NM_001300839.1	58	Intron			NP_001287768.1
NM_001300840.1	58	Intron			NP_001287769.1
NM_001300841.1	58	Intron			NP_001287770.1
NM_144697.3	58	UTR 5			NP_653298.1
XM_017000378.1	58	UTR 5			XP_016855867.1

View Full Product Details