Product Details

SNP ID: rs9296091
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:33318891 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATTTAGAGGATAAAATGGGTGGGA[A/G]AAAGGAAGAGACAGGATGTGGCACG
Phenotype: MIM: 603186 MIM: 601962 MIM: 611439
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DAXX PubMed Links

Gene Details

Gene: DAXX
Gene Name: death domain associated protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001141969.1		Intron			NP_001135441.1
NM_001141970.1		Intron			NP_001135442.1
NM_001254717.1		Intron			NP_001241646.1
NM_001350.4		Intron			NP_001341.1
XM_005248860.3		Intron			XP_005248917.1

Gene: TAPBP
Gene Name: TAP binding protein (tapasin)

There are no transcripts associated with this gene.

Gene: ZBTB22
Gene Name: zinc finger and BTB domain containing 22

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145338.1		Intron			NP_001138810.1
NM_005453.4		Intron			NP_005444.4

View Full Product Details