Product Details

SNP ID: rs7250622
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:18874034 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGAAAACAGGCTGATGAGGCCAGTG[A/G]TGGAGAAGAGCAGAGAGCACGTTCT
Phenotype: MIM: 606919 MIM: 602880 MIM: 601430
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CERS1 PubMed Links

Gene Details

Gene: CERS1
Gene Name: ceramide synthase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001290265.1		Intron			NP_001277194.1
NM_021267.4		Intron			NP_067090.1
NM_198207.2		Intron			NP_937850.1

Gene: GDF1
Gene Name: growth differentiation factor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001492.5		Intron			NP_001483.3

Gene: UPF1
Gene Name: UPF1, RNA helicase and ATPase

There are no transcripts associated with this gene.

View Full Product Details