Product Details

SNP ID: rs6027204
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:59933085 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCCGCAGCGCCAACCCCCCTTCAG[A/G]TGTCCCGGAGACAGGCGAGCAGCGG
Phenotype: MIM: 603326 MIM: 604105
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAM217B PubMed Links

Gene Details

Gene: FAM217B
Gene Name: family with sequence similarity 217 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001190826.1		Intron			NP_001177755.1
NM_001190827.1		Intron			NP_001177756.1
NM_022106.2		Intron			NP_071389.1
XM_011528985.2		Intron			XP_011527287.1
XM_011528986.2		Intron			XP_011527288.1

Gene: PPP1R3D
Gene Name: protein phosphatase 1 regulatory subunit 3D

There are no transcripts associated with this gene.

Gene: SYCP2
Gene Name: synaptonemal complex protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014258.3		Intron			NP_055073.2
XM_011528487.2		Intron			XP_011526789.1
XM_011528488.2		Intron			XP_011526790.1
XM_011528489.2		Intron			XP_011526791.1
XM_011528490.2		Intron			XP_011526792.1
XM_011528493.2		Intron			XP_011526795.1
XM_017027586.1		Intron			XP_016883075.1
XM_017027587.1		Intron			XP_016883076.1
XM_017027588.1		Intron			XP_016883077.1
XM_017027589.1		Intron			XP_016883078.1
XM_017027590.1		Intron			XP_016883079.1
XM_017027591.1		Intron			XP_016883080.1
XM_017027592.1		Intron			XP_016883081.1

View Full Product Details