Product Details

SNP ID: rs5983914
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:149882563 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCAAGATGTGCTCACTTTGTGATGA[A/C]TGGGGGTACTCCTGGCCTGGAAAGA
Phenotype: MIM: 300892 MIM: 300341
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LINC00850 PubMed Links

Gene Details

Gene: LINC00850
Gene Name: long intergenic non-protein coding RNA 850

There are no transcripts associated with this gene.

Gene: MAGEA8
Gene Name: MAGE family member A8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001166400.1		Intron			NP_001159872.1
NM_001166401.1		Intron			NP_001159873.1
NM_005364.4		Intron			NP_005355.2
XM_017029520.1		Intron			XP_016885009.1

Gene: MAGEA8-AS1
Gene Name: MAGEA8 antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

View Full Product Details