Product Details

SNP ID

rs6084916

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.20:4854991 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGAGCAACTCATTGCAGGAGGGCTG[C/G]CAGCCTCAAGAGTGTCCCAAGGCAA

Phenotype

MIM: 603791

Polymorphism

C/G, Transversion Substitution

Allele Nomenclature

Literature Links

SLC23A2 PubMed Links

Additional Information

For this assay, SNP(s) [rs142428111] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

SLC23A2

Gene Name

solute carrier family 23 member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005116.5	4332	UTR 3			NP_005107.4
NM_203327.1	4332	UTR 3			NP_976072.1
XM_011529414.2	4332	UTR 3			XP_011527716.1
XM_011529415.2	4332	UTR 3			XP_011527717.1
XM_011529416.2	4332	UTR 3			XP_011527718.1
XM_011529417.2	4332	UTR 3			XP_011527719.1
XM_017028171.1	4332	UTR 3			XP_016883660.1
XM_017028172.1	4332	UTR 3			XP_016883661.1
XM_017028173.1	4332	UTR 3			XP_016883662.1
XM_017028174.1	4332	UTR 3			XP_016883663.1
XM_017028175.1	4332	UTR 3			XP_016883664.1
XM_017028176.1	4332	UTR 3			XP_016883665.1
XM_017028177.1	4332	UTR 3			XP_016883666.1
XM_017028178.1	4332	UTR 3			XP_016883667.1
XM_017028179.1	4332	UTR 3			XP_016883668.1
XM_017028180.1	4332	UTR 3			XP_016883669.1
XM_017028181.1	4332	Intron			XP_016883670.1

View Full Product Details