Product Details

SNP ID: rs11708257
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:47016567 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAAAACCACAAGGCAGCCTGCTTT[A/G]GAATATTTACATGATAACAAATTAA
Phenotype: MIM: 614169 MIM: 612778
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NBEAL2 PubMed Links

Gene Details

Gene: NBEAL2
Gene Name: neurobeachin like 2

There are no transcripts associated with this gene.

Gene: NRADDP
Gene Name: neurotrophin receptor associated death domain, pseudogene

There are no transcripts associated with this gene.

Gene: SETD2
Gene Name: SET domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014159.6	9770	UTR 3			NP_054878.5
XM_011533631.2	9770	UTR 3			XP_011531933.1
XM_011533632.2	9770	UTR 3			XP_011531934.1
XM_011533633.2	9770	UTR 3			XP_011531935.1
XM_011533634.1	9770	UTR 3			XP_011531936.1
XM_017006270.1	9770	UTR 3			XP_016861759.1

View Full Product Details