Product Details

SNP ID
rs12893429
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.14:72613856 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
GCCCGCCGCACAGCCAGGCCTCCCC[A/G]GGGACAGCTGCTGAGAGGCTCTAAG
Phenotype
MIM: 601672 MIM: 603894
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
DPF3 PubMed Links
Additional Information
For this assay, SNP(s) [rs79513088] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
DPF3
Gene Name
double PHD fingers 3
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001280542.1 Intron NP_001267471.1
NM_001280543.1 Intron NP_001267472.1
NM_001280544.1 Intron NP_001267473.1
NM_012074.4 Intron NP_036206.3
XM_017021670.1 Intron XP_016877159.1
XM_017021671.1 Intron XP_016877160.1
XM_017021672.1 Intron XP_016877161.1
XM_017021673.1 Intron XP_016877162.1
XM_017021674.1 Intron XP_016877163.1
XM_017021675.1 Intron XP_016877164.1
Gene
RGS6
Gene Name
regulator of G-protein signaling 6
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001204416.2 Intron NP_001191345.1
NM_001204417.2 Intron NP_001191346.1
NM_001204418.2 Intron NP_001191347.1
NM_001204419.2 Intron NP_001191348.1
NM_001204420.2 Intron NP_001191349.1
NM_001204421.2 Intron NP_001191350.1
NM_001204422.2 Intron NP_001191351.1
NM_001204423.1 Intron NP_001191352.1
NM_001204424.1 Intron NP_001191353.1
NM_004296.6 Intron NP_004287.3
XM_011537393.2 Intron XP_011535695.1
XM_011537397.1 Intron XP_011535699.1
XM_011537407.2 Intron XP_011535709.1
XM_017021818.1 Intron XP_016877307.1
XM_017021819.1 Intron XP_016877308.1
XM_017021820.1 Intron XP_016877309.1
XM_017021821.1 Intron XP_016877310.1
XM_017021822.1 Intron XP_016877311.1
XM_017021823.1 Intron XP_016877312.1
XM_017021824.1 Intron XP_016877313.1
XM_017021825.1 Intron XP_016877314.1
XM_017021826.1 Intron XP_016877315.1
XM_017021827.1 Intron XP_016877316.1
XM_017021828.1 Intron XP_016877317.1
XM_017021829.1 Intron XP_016877318.1
XM_017021830.1 Intron XP_016877319.1
XM_017021831.1 Intron XP_016877320.1
XM_017021832.1 Intron XP_016877321.1
XM_017021833.1 Intron XP_016877322.1
XM_017021834.1 Intron XP_016877323.1

View Full Product Details