Product Details

SNP ID: rs8069167
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:32148412 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCTGCATAAAGAGTCTATTCTGTTC[A/G]TACAGAGTCCTTTCTATAACATCCT
Phenotype: MIM: 613888
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARGFXP2 PubMed Links

Gene Details

Gene: ARGFXP2
Gene Name: arginine-fifty homeobox pseudogene 2

There are no transcripts associated with this gene.

Gene: LOC105371730
Gene Name: uncharacterized LOC105371730

There are no transcripts associated with this gene.

Gene: RHOT1
Gene Name: ras homolog family member T1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001033566.2		Intron			NP_001028738.1
NM_001033567.2		Intron			NP_001028739.2
NM_001033568.2		Intron			NP_001028740.1
NM_001288754.1		Intron			NP_001275683.1
NM_001288755.1		Intron			NP_001275684.1
NM_001288758.1		Intron			NP_001275687.1
NM_018307.4		Intron			NP_060777.3
XM_011524969.2		Intron			XP_011523271.1
XM_011524971.2		Intron			XP_011523273.2
XM_011524973.2		Intron			XP_011523275.2
XM_011524975.2		Intron			XP_011523277.1
XM_011524976.2		Intron			XP_011523278.2
XM_017024819.1		Intron			XP_016880308.1
XM_017024820.1		Intron			XP_016880309.1
XM_017024821.1		Intron			XP_016880310.1
XM_017024822.1		Intron			XP_016880311.1
XM_017024823.1		Intron			XP_016880312.1
XM_017024824.1		Intron			XP_016880313.1
XM_017024825.1		Intron			XP_016880314.1

View Full Product Details