Product Details

SNP ID: rs12192171
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:34239092 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATGACGGAGCAGGATAAATCACCA[A/G]CCACCTTGTTTAAAAGGGTCTCCAA
Phenotype: MIM: 611419 MIM: 600701
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C6orf1 PubMed Links

Gene Details

Gene: C6orf1
Gene Name: chromosome 6 open reading frame 1

There are no transcripts associated with this gene.

Gene: HMGA1
Gene Name: high mobility group AT-hook 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001319077.1		Intron			NP_001306006.1
NM_001319078.1		Intron			NP_001306007.1
NM_001319079.1		Intron			NP_001306008.1
NM_001319080.1		Intron			NP_001306009.1
NM_001319081.1		Intron			NP_001306010.1
NM_001319082.1		Intron			NP_001306011.1
NM_002131.3		Intron			NP_002122.1
NM_145899.2		Intron			NP_665906.1
NM_145901.2		Intron			NP_665908.1
NM_145902.2		Intron			NP_665909.1
NM_145903.2		Intron			NP_665910.1
NM_145905.2		Intron			NP_665912.1

Gene: MIR6835
Gene Name: microRNA 6835

There are no transcripts associated with this gene.

View Full Product Details