Product Details

SNP ID

rs13053419

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.22:30695017 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CCTGCCTGTCGTGCCACACGGCGGC[G/T]CCGGGCATGAGCGCTTCCACGTCCG

Phenotype

MIM: 606729

Polymorphism

G/T, Transversion Substitution

Allele Nomenclature

Literature Links

OSBP2 PubMed Links

Additional Information

For this assay, SNP(s) [rs182152986] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

OSBP2

Gene Name

oxysterol binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282738.1	138	Intron			NP_001269667.1
NM_001282739.1	138	Silent Mutation	GCG,GCT	A36A	NP_001269668.1
NM_001282740.1	138	Intron			NP_001269669.1
NM_001282741.1	138	Intron			NP_001269670.1
NM_001282742.1	138	Intron			NP_001269671.1
NM_030758.3	138	Silent Mutation	GCG,GCT	A36A	NP_110385.1
XM_005261465.4	138	Silent Mutation	GCG,GCT	A36A	XP_005261522.1
XM_006724203.2	138	Silent Mutation	GCG,GCT	A36A	XP_006724266.2
XM_006724207.2	138	Intron			XP_006724270.1
XM_006724208.3	138	Intron			XP_006724271.1
XM_011530057.1	138	Silent Mutation	GCG,GCT	A36A	XP_011528359.1
XM_011530058.1	138	Silent Mutation	GCG,GCT	A36A	XP_011528360.1
XM_011530059.2	138	Silent Mutation	GCG,GCT	A36A	XP_011528361.1
XM_011530060.1	138	Intron			XP_011528362.1
XM_011530061.1	138	Intron			XP_011528363.1
XM_011530062.1	138	Intron			XP_011528364.1
XM_017028708.1	138	Silent Mutation	GCG,GCT	A36A	XP_016884197.1
XM_017028709.1	138	Silent Mutation	GCG,GCT	A36A	XP_016884198.1
XM_017028710.1	138	Intron			XP_016884199.1
XM_017028711.1	138	UTR 5			XP_016884200.1
XM_017028712.1	138	Intron			XP_016884201.1
XM_017028713.1	138	Intron			XP_016884202.1

View Full Product Details