Product Details

SNP ID: rs3136818
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:20456290 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTCCTTCACTTCCATTGCCATTTTC[A/T]TTTTTAGTGTTCTCTCCTCTTCCCA
Phenotype: MIM: 107748 MIM: 610107 MIM: 609865
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: APEX1 PubMed Links

Gene Details

Gene: APEX1
Gene Name: apurinic/apyrimidinic endodeoxyribonuclease 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001244249.1		Intron			NP_001231178.1
NM_001641.3		Intron			NP_001632.2
NM_080648.2		Intron			NP_542379.1
NM_080649.2		Intron			NP_542380.1

Gene: OSGEP
Gene Name: O-sialoglycoprotein endopeptidase

There are no transcripts associated with this gene.

Gene: TMEM55B
Gene Name: transmembrane protein 55B

There are no transcripts associated with this gene.

View Full Product Details