Product Details

SNP ID: rs16968036
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:42842133 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATCCCACTTTGAATCTTGATCGTGA[C/G]AAGAAATACCTTAGGCCTTCAGTCA
Phenotype: MIM: 602268 MIM: 603735 MIM: 605129
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: AOC2 PubMed Links

Gene Details

Gene: AOC2
Gene Name: amine oxidase, copper containing 2

There are no transcripts associated with this gene.

Gene: AOC3
Gene Name: amine oxidase, copper containing 3

There are no transcripts associated with this gene.

Gene: PSME3
Gene Name: proteasome activator subunit 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267045.1	1810	UTR 3			NP_001253974.1
NM_005789.3	1810	UTR 3			NP_005780.2
NM_176863.2	1810	UTR 3			NP_789839.1
XM_011524177.2	1810	UTR 3			XP_011522479.1

View Full Product Details