Product Details

SNP ID: rs72549348
Assay Type: DME
NCBI dbSNP Submissions: NA
Location: Chr.22:42127619 on Build GRCh38
Set Membership: DME Validated Inventoried
Context Sequence [VIC/FAM]: CACCTGCCCTATCACGTCGTCGATC[G/T]CCTGTTGGACACGGCCTGGACAGAC
Phenotype: MIM: 124030
Polymorphism: G/T, Transversion substitution
Allele Nomenclature: CYP2D6*51,g.3172A>C
Literature Links: CYP2D6 PubMed Links
Additional Information: The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
For this assay, SNP(s) [rs59421388] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000106.5	938	Missense Mutation	GAG,GCG	E334A	NP_000097.3
NM_001025161.2	938	Missense Mutation	GAG,GCG	E283A	NP_001020332.2
XM_011529966.2	938	Intron			XP_011528268.1
XM_011529968.2	938	Intron			XP_011528270.1
XM_011529970.2	938	Intron			XP_011528272.1
XM_011529972.2	938	Intron			XP_011528274.1

There are no transcripts associated with this gene.

There are no transcripts associated with this gene.