Product Details

SNP ID: rs7269669
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:18474900 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTTAGAAATTATAAATCATTATAAT[A/T]AGTCTTACAAAGCATTATACTTATT
Phenotype
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: DZANK1 PubMed Links

Gene Details

Gene: DZANK1
Gene Name: double zinc ribbon and ankyrin repeat domains 1

There are no transcripts associated with this gene.

Gene: MIR3192
Gene Name: microRNA 3192

There are no transcripts associated with this gene.

Gene: POLR3F
Gene Name: RNA polymerase III subunit F

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282526.1		Intron			NP_001269455.1
NM_006466.3		Intron			NP_006457.2
XM_011529141.1		Intron			XP_011527443.1
XM_017027596.1		Intron			XP_016883085.1

View Full Product Details