Product Details
- SNP ID
-
rs8010006
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.14:90072672 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTAAAAGGAACTAAGGGCAGTTACA[C/T]TCTCTTAAACTCTTCTGATTTCTGC
- Phenotype
-
MIM: 607367
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
KCNK13
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs143686620] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KCNK13
- Gene Name
- potassium two pore domain channel subfamily K member 13
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_022054.3 |
|
Intron |
|
|
NP_071337.2 |
View Full Product Details