Product Details

SNP ID: rs11551598
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:123058779 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCAGGAGGTATGCCTGTGAGTTCAA[A/G]CTTGCCAAGCAGGTTGTTATCCTTT
Phenotype: MIM: 600816
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HSPA8 PubMed Links

Gene Details

Gene: HSPA8
Gene Name: heat shock protein family A (Hsp70) member 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006597.5	1652	Missense Mutation	CTT,TTT	L459F	NP_006588.1
NM_153201.3	1652	Missense Mutation	CTT,TTT	L459F	NP_694881.1
XM_011542798.1	1652	Intron			XP_011541100.1

Gene: SNORD14C
Gene Name: small nucleolar RNA, C/D box 14C

There are no transcripts associated with this gene.

Gene: SNORD14D
Gene Name: small nucleolar RNA, C/D box 14D

There are no transcripts associated with this gene.

Gene: SNORD14E
Gene Name: small nucleolar RNA, C/D box 14E

There are no transcripts associated with this gene.

View Full Product Details