Product Details
- SNP ID
-
rs143815991
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.20:23750759 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GTACCCACTCATCATTGAGGTCTGC[A/G]TTATAGATGCCACCCGGGATTATCC
- Phenotype
-
MIM: 123855
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CST1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs77188058] are located under a probe and SNP(s) [rs6076122] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CST1
- Gene Name
- cystatin SN
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001898.2 |
179 |
Silent Mutation |
|
|
NP_001889.2 |
View Full Product Details