Product Details
- SNP ID
-
hCV61815464
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:50274999 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ACCCGCAGAGTGAAAAAGACGCTGT[A/T]TTTGATTTACAATGAACAAGATTTA
- Phenotype
-
MIM: 602898
MIM: 604293
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
MAPK11
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs113489660] are located under a probe and SNP(s) [rs114409950] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MAPK11
- Gene Name
- mitogen-activated protein kinase 11
There are no transcripts associated with this gene.
- Gene
- PLXNB2
- Gene Name
- plexin B2
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_012401.3 |
6315 |
UTR 3 |
|
|
NP_036533.2 |
View Full Product Details