Product Details

SNP ID: rs34310454
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1786230 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACCCACGTGTGTGTTTGCACACGC[A/G]CACGAAGGAACGCATGCACCCTTCC
Phenotype: MIM: 610886 MIM: 601489 MIM: 610779 MIM: 611659
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EME2 PubMed Links

Gene Details

Gene: EME2
Gene Name: essential meiotic structure-specific endonuclease subunit 2

There are no transcripts associated with this gene.

Gene: IGFALS
Gene Name: insulin like growth factor binding protein acid labile subunit

There are no transcripts associated with this gene.

Gene: NUBP2
Gene Name: nucleotide binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284501.1		Intron			NP_001271430.1
NM_001284502.1		Intron			NP_001271431.1
NM_012225.3		Intron			NP_036357.1
XM_005255027.2		Intron			XP_005255084.1
XM_005255030.1		Intron			XP_005255087.1
XM_011522338.2		Intron			XP_011520640.1
XM_017022831.1		Intron			XP_016878320.1
XM_017022832.1		Intron			XP_016878321.1

Gene: SPSB3
Gene Name: splA/ryanodine receptor domain and SOCS box containing 3

There are no transcripts associated with this gene.

View Full Product Details