Product Details

SNP ID

rs41265393

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.6:169702954 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GCCAGAAGCACGCTGGTGCCCCGGA[A/G]GACGCCTCGCAAGAGGAGGAATCTG

Phenotype

MIM: 616987 MIM: 613069

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

C6orf120 PubMed Links

Additional Information

For this assay, SNP(s) [rs150288859] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

C6orf120

Gene Name

chromosome 6 open reading frame 120

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001029863.2	843	Silent Mutation	GAA,GAG	E165E	NP_001025034.1
NM_001317342.1	843	Silent Mutation	GAA,GAG	E184E	NP_001304271.1

Gene

PHF10

Gene Name

PHD finger protein 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018288.3	843	Intron			NP_060758.2
NM_133325.2	843	Intron			NP_579866.2
XM_017010998.1	843	Intron			XP_016866487.1

Gene

WDR27

Gene Name

WD repeat domain 27

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001202550.1	843	Intron			NP_001189479.1
NM_182552.4	843	Intron			NP_872358.4
XM_011535682.2	843	Intron			XP_011533984.1
XM_011535684.2	843	Intron			XP_011533986.1
XM_011535685.2	843	Intron			XP_011533987.1
XM_011535687.2	843	Intron			XP_011533989.1
XM_011535688.2	843	Intron			XP_011533990.1
XM_011535689.2	843	Intron			XP_011533991.1
XM_011535690.2	843	Intron			XP_011533992.1
XM_011535691.2	843	Intron			XP_011533993.1
XM_011535692.2	843	Intron			XP_011533994.1
XM_011535693.2	843	Intron			XP_011533995.1
XM_011535694.2	843	Intron			XP_011533996.1
XM_011535696.2	843	Intron			XP_011533998.1
XM_011535697.2	843	Intron			XP_011533999.1
XM_017010658.1	843	Intron			XP_016866147.1
XM_017010659.1	843	Intron			XP_016866148.1
XM_017010660.1	843	Intron			XP_016866149.1
XM_017010661.1	843	Intron			XP_016866150.1
XM_017010662.1	843	Intron			XP_016866151.1
XM_017010663.1	843	Intron			XP_016866152.1
XM_017010664.1	843	Intron			XP_016866153.1
XM_017010665.1	843	Intron			XP_016866154.1
XM_017010666.1	843	Intron			XP_016866155.1
XM_017010667.1	843	Intron			XP_016866156.1
XM_017010668.1	843	Intron			XP_016866157.1
XM_017010669.1	843	Intron			XP_016866158.1
XM_017010670.1	843	Intron			XP_016866159.1
XM_017010671.1	843	Intron			XP_016866160.1
XM_017010672.1	843	Intron			XP_016866161.1
XM_017010673.1	843	Intron			XP_016866162.1
XM_017010674.1	843	Intron			XP_016866163.1
XM_017010675.1	843	Intron			XP_016866164.1

View Full Product Details