Product Details
- SNP ID
-
rs41281870
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.20:3250013 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCCATGTAAAAACATAAAATAACCC[A/G]TAACTTCAGCGACTTCAACATTATC
- Phenotype
-
MIM: 614146
MIM: 610206
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
C20orf194
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs143763428] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C20orf194
- Gene Name
- chromosome 20 open reading frame 194
- Gene
- SLC4A11
- Gene Name
- solute carrier family 4 member 11
There are no transcripts associated with this gene.
View Full Product Details