Product Details

SNP ID: rs56122560
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:50278576 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCCACTGGCCAGCATGGGTGCTGT[G/T]GGTGTATCTGCCCACTTGTGAAGCT
Phenotype: MIM: 602725 MIM: 601281
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: IFRD2 PubMed Links

Gene Details

Gene: IFRD2
Gene Name: interferon related developmental regulator 2

There are no transcripts associated with this gene.

Gene: LSMEM2
Gene Name: leucine rich single-pass membrane protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304385.1	267	Intron			NP_001291314.1
NM_153215.2	267	Intron			NP_694947.1
XM_006712979.3	267	UTR 5			XP_006713042.1
XM_006712980.3	267	UTR 5			XP_006713043.1
XM_011533370.2	267	Intron			XP_011531672.1

Gene: MIR6872
Gene Name: microRNA 6872

There are no transcripts associated with this gene.

Gene: SEMA3B
Gene Name: semaphorin 3B

There are no transcripts associated with this gene.

View Full Product Details