Product Details

SNP ID: rs72706661
Assay Type: Functionally tested
NCBI dbSNP Submissions: 17
Location: Chr.1:160212225 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTGGAGGCTTTAGGGAAGAATTG[G/T]TGTTTAAGATGGCCCTGAAAGGTGA
Phenotype: MIM: 615820 MIM: 603434
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: DCAF8 PubMed Links

Gene Details

Gene: DCAF8
Gene Name: DDB1 and CUL4 associated factor 8

There are no transcripts associated with this gene.

Gene: LOC729867
Gene Name: uncharacterized LOC729867

There are no transcripts associated with this gene.

Gene: PEA15
Gene Name: phosphoprotein enriched in astrocytes 15

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297576.1		Intron			NP_001284505.1
NM_001297577.1		Intron			NP_001284506.1
NM_001297578.1		Intron			NP_001284507.1
NM_003768.4		Intron			NP_003759.1
XM_006711599.2		Intron			XP_006711662.1

View Full Product Details