Product Details

SNP ID: rs66775024
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100867997 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TACTCCAGCACACGCAGGTGAGACC[C/T]GGGATCGTGGGGTGGGACATGTGGG
Phenotype: MIM: 616861 MIM: 614469 MIM: 602933
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR6875 PubMed Links

Gene Details

Gene: MIR6875
Gene Name: microRNA 6875

There are no transcripts associated with this gene.

Gene: SLC12A9
Gene Name: solute carrier family 12 member 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267812.1		Intron			NP_001254741.1
NM_001267814.1		Intron			NP_001254743.1
NM_020246.3		Intron			NP_064631.2
XM_005250502.2		Intron			XP_005250559.1
XM_005250504.4		Intron			XP_005250561.1
XM_006716054.2		Intron			XP_006716117.1
XM_006716055.2		Intron			XP_006716118.1
XM_011516414.1		Intron			XP_011514716.1

Gene: SRRT
Gene Name: serrate, RNA effector molecule

There are no transcripts associated with this gene.

Gene: TRIP6
Gene Name: thyroid hormone receptor interactor 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003302.2		Intron			NP_003293.2

View Full Product Details