Product Details

SNP ID: rs73568071
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:112075694 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCAACGCTTACTGAAGGCAAGCAGT[A/G]TGCCAAGCATTATTTTGGAACAACT
Phenotype: MIM: 606659
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C11orf57 PubMed Links

Gene Details

Gene: C11orf57
Gene Name: chromosome 11 open reading frame 57

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001082969.1		Intron			NP_001076438.1
NM_001082970.1		Intron			NP_001076439.1
NM_001301017.1		Intron			NP_001287946.1
NM_001301019.1		Intron			NP_001287948.1
NM_001301021.1		Intron			NP_001287950.1
NM_018195.3		Intron			NP_060665.3

Gene: PIH1D2
Gene Name: PIH1 domain containing 2

There are no transcripts associated with this gene.

Gene: TIMM8B
Gene Name: translocase of inner mitochondrial membrane 8 homolog B

There are no transcripts associated with this gene.

View Full Product Details