Product Details

SNP ID: rs79638552
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:9480618 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAAAAGACCGGAAAGATATACATCC[A/C]AATGCCAACAGTGGTTTTCTGGGTG
Phenotype: MIM: 603639 MIM: 606029
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ADAM17 PubMed Links

Gene Details

Gene: ADAM17
Gene Name: ADAM metallopeptidase domain 17

There are no transcripts associated with this gene.

Gene: CPSF3
Gene Name: cleavage and polyadenylation specific factor 3

There are no transcripts associated with this gene.

Gene: IAH1
Gene Name: isoamyl acetate-hydrolyzing esterase 1 homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039613.2		Intron			NP_001034702.1
NM_001320858.1		Intron			NP_001307787.1
NM_001320859.1		Intron			NP_001307788.1
NM_001320860.1		Intron			NP_001307789.1
NM_001320863.1		Intron			NP_001307792.1
XM_017003878.1		Intron			XP_016859367.1

View Full Product Details