Product Details

SNP ID: rs35435358
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:41982520 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACGGTGTTGACAACACAGATAAGA[C/G]GAATCACATTTAGAAATAAGTAATC
Phenotype: MIM: 605892
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: EHD4 PubMed Links

Gene Details

Gene: EHD4
Gene Name: EH domain containing 4

There are no transcripts associated with this gene.

Gene: PLA2G4E
Gene Name: phospholipase A2 group IVE

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001206670.1	3751	UTR 3			NP_001193599.1
XM_011521237.2	3751	UTR 3			XP_011519539.1
XM_011521238.1	3751	Intron			XP_011519540.1
XM_011521239.1	3751	Intron			XP_011519541.1

Gene: PLA2G4E-AS1
Gene Name: PLA2G4E antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details