Product Details

SNP ID: rs2659009
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:81239505 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGGAGGAGCCGCGCGGGGAGGTG[A/G]CTGGGAGGGAGGACGGTGACGGGGT
Phenotype: MIM: 616525
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C17orf89 PubMed Links

Gene Details

Gene: C17orf89
Gene Name: chromosome 17 open reading frame 89

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001086521.1		Intron			NP_001079990.1

Gene: LOC105371925
Gene Name: uncharacterized LOC105371925

There are no transcripts associated with this gene.

Gene: SLC38A10
Gene Name: solute carrier family 38 member 10

There are no transcripts associated with this gene.

Gene: TEPSIN
Gene Name: TEPSIN, adaptor related protein complex 4 accessory protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144679.2		Intron			NP_653280.1
XM_005257066.2		Intron			XP_005257123.1
XM_005257067.2		Intron			XP_005257124.1
XM_006721709.3		Intron			XP_006721772.1
XM_006721712.2		Intron			XP_006721775.1
XM_011524355.1		Intron			XP_011522657.1
XM_011524356.1		Intron			XP_011522658.1
XM_011524357.1		Intron			XP_011522659.1
XM_011524358.2		Intron			XP_011522660.1
XM_017024202.1		Intron			XP_016879691.1
XM_017024203.1		Intron			XP_016879692.1
XM_017024204.1		Intron			XP_016879693.1

View Full Product Details